?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD9YE14FM1
Length(NT) : 683
Member of Contig: SY0AAD9YE14FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein NCU06252 [Neurospora crassa OR74A]3653e-33 ref|XP_962856.1|

Sequence:

>SY0AAD9YE14FM1
TTGGCAATGGCATTCCAGGTGGCATGCGATTACCTCTCACCCCAGGTTTC
AGGCAGCCGCGGTTGTTTCAACCGCGTCACAGCTTCAACTCTTGCAATGC
ACGTGACGCTTTGTCAACTTCCCCCTCCTCATCAACAACTAATTCGCCCC
CCAAAAGTCCTGAGGTGTTACATGAGATGGACGAGGAAGATGAGGAGCCA
AGATCTGGAGAAGCAAAATCGCCTGCCTACCCTTCCGGCCCTGTTTGCAT
TTTTGATCCTAATATCTATCTATACGCCGAACCTGATGCTGAGCTCGCAT
CGCAATTCGATGTTATTGTGAATGTAGCGAGGGAGGTCGTTAACCCGTTC
AAGACAGATAAAAACTTGACTGCCGCCAAGGCTGCACTAGGCGCCAACTG
CAAGGATGCGGAGTCGGACTCACTGCCACCTGACACCGCCTGCACGGAAG
CAAGTTTTACAACCGCCTTTGAGGAAGCCTTATTTTCCCCCGTACTAGCG
TCCTCCCGCAGGCCTAAATTAGACGCACTAGGACCAAAACACAAGCAGCC
CGAGTATGTGCATATGCTATGGGATCATAATACACCAATCCTAGACGATT
TGCCTCATTTGGTGAACCTGATTAACGACAGAGCGAGCGCAGGAAAGAAA
GTGCTTGTTCATTGTCAATGTGGCGTTAGCCGT

NCBI BlastX