?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD6YH20FM1
Length(NT) : 592
Member of Contig: SY0AAD6YH20FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein CHGG_04528 [Chaetomium globosum CBS 148.51]5055e-52 ref|XP_001223742.1|

Sequence:

>SY0AAD6YH20FM1
TTGGCTCAAGGAACATCTTCCTATTAGCATATTCAACATTTCGCTCTCGC
AATGTCTACCTCTGCTCGCCGTCGTCTCATGAGAGATTTCAAGGTATCTA
CCCCACTCATTACGGCCAGCCAAAGAAGCCCGAGTCATGACCCAACCGGT
ACTAACGAGTTTTCTCCCAGAGAATGCAAACAGACCCGCCGGCCGGTGTT
AGTGCGTCTCCCATTAGCGATAATGTCATGACCTGGAACGCCGTTATAAT
TGGTCCTGTTGATACTCCATTTGAGGATGGCACTTTCCGTCTCGTTATGC
ATTTCGAAGAGCAGTACCCGAACAAGCCTCCGTCTGTGAAATTCATCAGT
CAAATGTTCCACCCAAATGTCTACGCCACTGGTGAACTTTGTTTGGATAT
CTTGCAAAATAGATGGAGCCCAACCTATGATGTTGCCGCTATTCTGACCA
GTATTCAAAGGTCAGTTCCTCTCTCTATTTTCTAATTATCTCGTCGCCAT
CGCGTCTACTCGCATCCCAGTCATCCTGGATATTCAGCTTTCATGACCTG
GTCAGAGCCCGCTCTAACTCGCTCCCTTATCTAGTCTTCTGA

NCBI BlastX