?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD63YH01FM1
Length(NT) : 424
Member of Contig: SY0AAD63YH01FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein FG06640.1 [Gibberella zeae PH-1]3336e-30 ref|XP_386816.1|

Sequence:

>SY0AAD63YH01FM1
TTGGATGTGATACGATAGGGCAAAGAAAACAAGCAAAGCCAGACCTCCTT
CTCGATTTCGCTCCCCCTTTCCCAATACCGTACTACACGATAAACGGGTT
TCTCACAATTCAGCTGAGCGCCACCAGCACGACGACCGCAGCAAACGTTA
AACCCTAGGAAGGGAAAAGAAAATAATACAAAAAACAAAAACAAAAAAAA
GCAAGATGCTCGCAATATTACGGAAATCACGACTGAAGGATCAGGAGATG
CGCGTGTTAATGCTGGGACTTGACAATGCCGGAAAAACCACCATCGTCAA
GCACGTCATGGGCGAGGATGTGAGGACTGTGAGTCCCACGTTGGGATTCA
TTATCAAGACAATCGATTACAAAGGTTTCAAGCTGAACATATGGGATGTG
GGCGGCCAAAAAACCCTCCGCAGT

NCBI BlastX