?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD62YH24FM1
Length(NT) : 544
Member of Contig: SY0AAD62YH24FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
conserved hypothetical protein [Aspergillus terreus NIH2624]3947e-37 ref|XP_001212453.1|

Sequence:

>SY0AAD62YH24FM1
TTGGAAGAAACCGAAAATGTCACAATCCCCCAGTAATAATATCAACTCTT
CCAACGGGTCGTACAAAACACCACTCTGGTATGCTGCTAATAATGGGCAC
GAGGAAGTGGTGAAAATGCTGCTAGGGCGGCGGGATATCAGCCCCGAGAA
ACCAGATCGCAGCGGCCACACACCACTCTGGTATGCTGCTCACAATGGGC
ACGAGGGGGTGGTGGATGCGCTACTCGGACGGGACGAAGTCAAGCCCGGT
AGATCGGACCGGTTAGGCCTAACTCCACTTCATCTTGCTGCTATGAGAGG
GTGCGAGGGAGTGGTGAAAATACTACTCGGACGGGACGACGTCAACCCCG
ACGAACCAGATAACCACGGCCAAACACCCCTCATCTGCGCTGCTCAGGGT
GGGCACGAAGGGGTGGTGCAAACACTACTCGAACGGGACGACGTTAACCC
CGACAAGCCAGGTAACGACGGCCGGACACCGCTCCATTGCGCTGCTTCCA
GTGGGCACGAGGGAGTGGTGAAGATTCTACTCGGGCGGGACGAC

NCBI BlastX