?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD5YH23FM1
Length(NT) : 534
Member of Contig: SY0AAD5YH23FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein FG01856.1 [Gibberella zeae PH-1]4323e-41 ref|XP_382032.1|

Sequence:

>SY0AAD5YH23FM1
TTGGCCTTCTCTAGCTTAAACCCGCACATCTGGACTAGTGCAAGGACTTC
ATCGAGGCACAGCTCGAACTTTCCCGCAGCTCCCACGTCCTCATCTTCCC
CGCTATCCCTCCTCTTCCGTTGTTGCTGCTCCTGGGCATGCTCTTCAAAG
TGCCAGAGCAGCGGTCCAAAGTTCACCCAGATCCCGTCGTCGACAAGCAA
GTGCTTGATGGTCTCAAGGTAGGAGATTAAGTTCGGTGCTGTGTCGATGA
AGAATACGGTGGCGCAGACGTCAAATTTTTGCGAGGGGGGGAGGTCTTTG
TAGGATTGGCGGAAGTCGCCCGCTGTCATGCTGAATCTGTCGGTACCCGT
GAGCTCGAGAAGGGTTTCGGGATGGACGTCTGGGATTTGGATGCCGCGGA
GGTGGTCGGGGCGGGTGGAATGATTGCTGAAGATTGAGATGAAGGGGTGG
AGGGTGTGTTGATATGCGGTGGTGGTGTGATTTAGGATGTAGTTGCTGGC
CATCAGTTGGTGGTAGGAGAATTCATTTCCTTGG

NCBI BlastX