?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD5YF08FM1
Length(NT) : 517
Member of Contig: SY0AAD5YF08FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
Ankyrin repeat protein [Aspergillus fumigatus A1163]3061e-26 gb|EDP48589.1|

Sequence:

>SY0AAD5YF08FM1
TTGGGCAGGGTCCATATTTTCACATTAATGGTTGCGATAGACTTTCCAGT
TCAATGGTTTACACTGTGCATGCATGTTCGGGATCGTTGAGATTGTAGCT
GAATTGCTCGAGGTAGAAGGCTGCGATATCAACCAACGAGACTGCACGGG
CAATACACCACTCGCGTGGGCTGCTTGGAATGGGTACGGAGGAGTGGTGG
GAATACTACCCGGGCGGAACGACGTCGACCCCAATAAATTAGATAAGGAT
GGCGATACACCGCTTCATTGTGCTGCCTTTAATGGGCACGAAGGGGTGGT
GAAAATACTTCTCGAACGGAACGACGTCAGCCCCGATAGACCGGATAATA
ACAGCCGAACACCACTCTGGTGGGCTGCTCAGAATGGGCACGAGGGAGTG
GTGAAGATACTACTCGGACGGGACGACGTCAATCCAGGCAGACCGGACTG
GCATGGCCGAACATCACTCTGGTGGGCTGCTGAGAATGACCGTGCCGGGG
TGGTGGCGCTGCTGGTG

NCBI BlastX