?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD5YB21FM1
Length(NT) : 416
Member of Contig: Contig4483


Sequence:

>SY0AAD5YB21FM1
TTGGCTTCCTCTCTGAATACCAAAGCTTTGAGATACCGAAAAAATCCATC
CTTTGCTATCATGGCTTATACTGGGTCTACACGGAACGTGGACATGAGCA
GATCCGAATCTGACCTCGTGATAAACATTAAGAAGGCTACCAATATGGAG
GAGACCGCTCCTAAACGAAAACATGTCCGTTCTTGCATTGTTTACACATG
GGACCACAAATCGTCGCAGTCCTTCTGGGCTGGTATGAAAGTGCAGCCTA
TCATGGCGGATGAGGTCCAGACGTTCAAGGCGTTGATAAGTATCCACAAA
GTTCTCCAGGAAGGTCACCCTGTGACAATTCGTGAGGCTCATGCACATAC
TGGGTGGTTGGAGTCTCTGACCCGAGGGGTAGCCGGGGAGGGGCTACGGG
GATACGGTCCTTTGAT

NCBI BlastX