?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD5YA15FM1
Length(NT) : 588
Member of Contig: SY0AAD5YA15FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein AN0806.2 [Aspergillus nidulans FGSC A4]2201e-16 ref|XP_658410.1|

Sequence:

>SY0AAD5YA15FM1
TTGGATAACCTTCTCCAAATCTACCCTAACGCCAACAAGCACCATCCCAC
ACGCACACACAAACATAACCTCACTTGGCACCTACCCCGCATCACCACAG
ACCCTGCTAACCTCGGGCGCTGACGGGCTCATAAAACTCTGGGACCTCCG
CTGCTCCCCGACAGCCGCTTTGGCGAGCAAGATAAACGTGGGCGCACCAG
TACTATGCGCTTCTGCGAACGCTCAGGGCGGAATCATCGCGGGGACCGAG
GTGCAGGATCGGGCCTCGAGGGTCTGTGTTTGGGATGGGAGAGTGGTGGG
GGAGAAGCCGACCTGGGTGTTCACGGAGAGTCATGGGGATGATGTCTCGT
TTGTGGGGTTTGCCGGGGGAGAAGAGGAGGGGAGGTGGGGAGTTAGTGGG
GGGATGGATGGACTGGTTAATGTTTTTGATTTGCTGGCTGGGAAGGGAGC
GGGAAGGGAGGATGATGATGAGAAGGCACTTTGGCAAGTGGTTAATGTTG
GGGCTTCGGTTCACCGGGCGGGGTTTTTGAATGCTGGTGGCGGTGGTGGT
ATTGTTGGGAAAGGGGAGTGGGTTTTTGGGGTATCGAC

NCBI BlastX