?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD59YF23FM1
Length(NT) : 559
Member of Contig: SY0AAD59YF23FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
Amidohydrolase 2 [Burkholderia sp. 383]1545e-09 ref|YP_373709.1|

Sequence:

>SY0AAD59YF23FM1
TTGGGATACACATCACCACTACTTCGGGGACTCGGTCCCAGAACTGGTAT
CAGAATTCACAAACGATGGAGCTCAAGCCTTCTTCTTCCCAAAGGGCGTG
GACGACCACTTGAAGTACATGGATTCCATGGGAATCCAGACGGCCGTACT
GGCGCCAAGTATCAAGATGGAATGGCATACCCAATGGCCACCGGCGAGAT
GGAAGAACCTGTGCGAGAGGACGCTGAAAGCCCAGCTGAAGGTTCAGGAA
TCGAATCCGCTCCGCTTTGGTATGCTTTTATCTTTCCAATTCTTTGCGCA
AAAGTGTGGCGCGGGCTTATCAAAAGCACGAAGGGACGTTTGCCATGCTC
CCCTTCCCGCATGTTAACGAGACTTTGGACTTCGTGAGGGATATATACAC
CCGTGAGGTCAAGCCAGATGGTTTCGCGCTGTCTACGGCTATGGGGAATA
AATACCTCGGTGATCCAGCCTTCGATCCCATGTGGGACGAATTGAATATG
CATAGCGCAGCGATTTTCGTCCACCCTGCGGACACTGCAATGCCGCCGGG
ACTGGAGTA

NCBI BlastX