?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD57YP11FM1
Length(NT) : 344
Member of Contig: SY0AAD57YP11FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
cytochrome c heme lyase [Aspergillus terreus NIH2624]2729e-29 ref|XP_001211930.1|

Sequence:

>SY0AAD57YP11FM1
TTGGGTTTCAGGGGAAGAGTCGGGAGATGACGCCTAAGGCCAGGATGTTC
CAGGTGCTTGGGAGGGTTTACCCGGAAAAGTTTGGGTAGGTGATTAGTTT
GATTGATCGGTTGGTTGAGATGTGTGGAGACCGAGTTAATGATTGTGCGT
GTATTTCAGGGGACCTCCGCCGTTCGATAGGCATGATTGGTACGTACTTC
GACAGGGCGGGAGAGAAGTTCGCTACGTTATCGATTATTACTCTGCGCCA
CCGGAGCCTACAGGTGAGCCGGTTTTCTACCTGGATGTTAGACCCGCCAT
TGATAGGCCGAGTGCTATCCTCGAGAGAGCTATGGTGTGGGGAG

NCBI BlastX