?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD56YM22FM1
Length(NT) : 616
Member of Contig: SY0AAD56YM22FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
histidinol-phosphate aminotransferase [Ajellomyces capsulatus NAm1]5292e-52 ref|XP_001539124.1|

Sequence:

>SY0AAD56YM22FM1
TTGGAGCATACATCGACTTTGCACCCGAAGGAAGCAGTCTCGCCCCATGT
GTCGTCGACCACCCAAACCTCGTCGTTATGCAAACTCTATCTAAAGCCTT
CGGACTCGCAGGAATTAGACTCGGCGCGGCGTTCACGGCTCCGGAGATAG
CGCGGTTGTTAAACAACCTCAAAGCTCCCTACTCTGTTTCCTCCACGACC
TCTTCTCTCGCCATGGCCGCGCTTTCCCCCGCAGGATTGGCCGTCAAGAA
CGAGAATGTGCGTAGATTGTTGGTGCAGCGCGATAGGATTATTTCTGAAC
TTCCAGAGTTGCCGGGGATCGGGAGGTTTTTGGGCGGGTTTGATAGTAAC
TTTTTGCTGGTTGAGATTCTTGATAATAACGCGGTTCCGAATAGTGGGGT
TGCGAAGAAAGTGTATGAGCAACTTGCGGAGGAGCATGGGGTTATTGTTA
GGTACCGTGGCGGGGAGGCTGGGTGTACAGGTTGTCTTAGGATTACAGTT
GGCACCGAGGCGGAGGTTGGGAGATTGTTGAAGAAGTTGCGGGAGACGCT
TAACGCGGTTAGGGGGGAGTAGATATGTTACAAGTATCATACTTGAAGGT
GGATTTTGCCCTTGAT

NCBI BlastX