?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD55YM03FM1
Length(NT) : 595
Member of Contig: SY0AAD55YM03FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein An12g05680 [Aspergillus niger]1716e-11 ref|XP_001395633.1|

Sequence:

>SY0AAD55YM03FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCAGCAGACCAGACTTA
CGAATGCGTCGTGCGAGCATTGTTAGAAGACGCCAGGGTGGCAATCAACT
ACAACAGCTCCAGCAGTGGCACTCCGTTGCACGTTGCAGCAGTGAGGGGT
TCCGCGGCAGTAGTCGAACTTCTTCTGGGCGACCCGAGGGTGCAGGTCAA
CCTGCGCGACGGCAATGGCAATACCGCACTGCACCTCGCAGGCAGTCAGG
AGCACGAACAAATCGTGTCGCTGCTGCTCGCGCACAAGGACATCGACGTG
AATATTCCAAACAACGGCGGATGCTCAGTCAGGAACCTGGCGGATATCCC
CTCCCACTATCCCTCTAACATTCAGAAGTGGGTTCTGGCTCATGATGCCA
AAGGGAGAGTGAATGTGGGATGTCTCGGAAAGATGTATTGATAGGGGGTG
TATCGGATCTCTCTTTTTTTCTTTCTGTTTTTTTTTTTGCAGCTGTGCCT
TTTTGTGAATATGATAGAGCGGAGCAAGGTGTGCGAAAAAAGTTAGCGAG
TGGTTTCACTTTTTTCTTTTTCTTTTTCTTTTTGTCGAGAGTTTA

NCBI BlastX