?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD55YC14FM1
Length(NT) : 648
Member of Contig: SY0AAD55YC14FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein CIMG_02198 [Coccidioides immitis RS]1556e-09 ref|XP_001248427.1|

Sequence:

>SY0AAD55YC14FM1
TTGGCCGTCGCGCTGTGGAGCGGGCACGCACGCAGTTCTTGCAGAAAACT
AGACCCCGAAGGTGTGTGATGTGTGTTTGTGCGTGCTCTCATGTGCTCCC
CTCCCCTATCTTTTATTCTTCCCCCACTGCTTCCACCCTCAACCAACTGC
CTCTTGCCAAGGAGGTGACAGATGGGAACGGTTGTAGGAAACGAAAAGAA
AGAAAAATGGCCCATTTTTCCAAAATCGAAGAAGGCAAAGCAAAGAAAAT
ATCATCACACATGAGCCGCCCAGTTTGATCTTTGACTGCAATTCATACTA
AAATTATCCCCCGTGCTACCCGCCTCCGTAGTGCCAATCGGACATCCGAC
GTCCTAACAGGGTCATACTTCGACTACCTTCCGGTCGAGCTCATAATCAA
CATCTGCTGCCAGACCGACTGGAGGGACGTCACCCGTCTCCGCCTCGTCT
CCCGAGCCTTCAAGGAGCTCGTTGACGCTAACGAGTCTACCATCGCTACC
AGATGGATGGTCCCCGGATCATATTTGGCGCTGCTCTCGCAACTCTTCTA
CCCACCAAAATCTAGGACAGGAGACGGGGTGCGCCGGCCTACGATACAGT
ACTTTTGCGGACTAGAGAAGAGACATGCCACGTGCTCGACGTTGGCTT

NCBI BlastX