?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD53YM20FM1
Length(NT) : 554
Member of Contig: SY0AAD53YM20FM1

BlastX hits against the NCBI non-redundant database:
DefinitionScoreE_valueAccession Number
hypothetical protein An16g08720 [Aspergillus niger]3015e-26 ref|XP_001398170.1|

Sequence:

>SY0AAD53YM20FM1
TTGGTCCAATCATCCTGCAGTTAAACGTTTTCCTCACTCTTCCTGTTGTG
AAACTTAAAACGCTCTTCCCTTGTTCGACGCCCACAAAGATATATATCGT
ACCCACTTTTTCTCCTCCTCCCCTCGGAGAAATTTTGACATTTTTCCCCC
TTAAAAGCCTCCATTCCCTCCCCTCTTTCCGCCGTCATCACCGCCACTGG
TCAACGATAAGCAAACCTTCCATCCCCCCCTTTTCCCCTTGGTTTTCACT
TAAATTTCCACTCGATCCTTCCGTCAAATCACTTCGCCATGACTATTGCC
ACTCTACCAATTGAGGACGCTCCCCGCTTCCAGAAGGACAACCGTGGCTT
TGCCACCCGTGCTGTTCAAACCGGTTCCCCCCATGATCCCATCACTGGTG
CCGTCATTACTCCCATCTCACTCTCCACTACTTTCGCTCAAACCAGCGTC
GGAAACCCAGTTGGTCTCTACGAATACTCTCGTAGTTCTAATCCCAACAG
GGACAACTTCGAGCATGCCGTTGCTGCCCTAGAGAATGCCAATTACGCTT
TGGC

NCBI BlastX