?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD53YE08FM1
Length(NT) : 674
Member of Contig: Contig4382


Sequence:

>SY0AAD53YE08FM1
TTGGGCCGCGTTAATACGTACACCGTCGCTGGACGAGAGGCAGCAGTGGT
TGCTACCTCCGCTAGCTCCCAGATTCGAGGGAAAGAAGTTCTTGGTACTG
GACTTGGACGAGACCCTGGTACATAGTAGCTTCAAGGTCTTGCACCAAGC
CGATTTTACTATTCCTGTAGACATCGAGGGGAGTTTTCACAATGTCTATG
TTATTAAGAGACCCGGTGTAGATGAGTTCATGAAGAGAGTTGGTGAACTA
TACGAGGTCGTTGTATTTACAGCTTCTGTCTCGAAGTATGGCGATCCGTT
ACTAGATCAGCTAGATATCCATCACGTCGTCCATCATCGCCTTTTCAGGG
ATAGTTGCTTCAACAACCAGGGAAATTATGTGAAGGATCTATCCCAACTT
GGCCGGGACCTTAAGGATACTATCATCATCGACAACTCCCCTACAAGTTA
CATCTTCCACCCACAACACGCCGTGCCTATTAGCAGTTGGTTTTCCGATG
CTCACGACAACGAGTTATTAGATCTCATCCCCGTTCTAGAGGATCTGTCG
ACACAAGACGTTCGGGATGTAACGCTGGTCCTGGACGTATCCCTGTGACG
ATCCGTATAGGTGGCTCCTTGTGGTGGCTTTCGATGTTATGGTGGATTTG
CTTTTCTTGGTCTTTCTATTTTGA

NCBI BlastX