?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD4YF07FM1
Length(NT) : 665
Member of Contig: Contig1475


Sequence:

>SY0AAD4YF07FM1
AAAACAATATTAAGGGAAGGAAGATGTCGAGACCGCCGCTGAGCTTGACG
GCAGAATTGGAAAAGTTGGAGCAGAGTATTACGCTTACCTTGCAAGAAAT
TGATCACAACTTCAGTAAAGCCCATCGGATTGTCACGACCAGTATCATCC
CTATTGTTGAGCGATACGCGAAGGAGTCTGAGGCTGTTTGGGAGGGGTCG
AAGTTCTGGAAGCAATTCTTCGAAGCCAGTGCTAACGTCGCACTATCAAA
CTACCAAGAGGAAGAGGAGACATATGAAGAAACCGGCGTGGCTACCAATG
CAGAAACGTATATAACTGCCTCTTCGCCAGGAAATTACGGCGAGCAGTCC
ACACGGATAACGCAGGAAGACGACCCCCGACACCGCGGTCCCGAAGAGGA
CGACGATGACTACCTACTGGATGATTCACTATTAGAGTCGCTAAATTTGA
CAGCGGGAGGATTGGGTGGAGCAAGCACGCCCAAGGGGAAGCAACTCCAA
CGCACAGAGACACAGTGGGAGAACATCGAATCACCTTTCGATGCGCTGCG
CAAGGAGTTGGCCGGGAATGACTATACTATGCACGGCTCTCCCACCACCG
CCAATACCGCTGCCGCTCCTGCCGCCGGCGCAACCGGCTGCGAAGACTCC
TTCGGCAGCGACGAC

NCBI BlastX