?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD49YI06FM1
Length(NT) : 114
Member of Contig: Contig4341


Sequence:

>SY0AAD49YI06FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCCGCACAACTTTGTAC
AAGAAAGTTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTT

NCBI BlastX