?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD48YO02FM1
Length(NT) : 605
Member of Contig: Contig136


Sequence:

>SY0AAD48YO02FM1
TTGGAAGGCAAACTCCATCGAGAAAATGTCTGAAATACCCTCGAAATGGA
AGTGCGCCGTAATCCAACTCCACTCCAAGCCGATGCAGCTGGAGGACAAC
TTCAATCGTGCCCAGGGCTTCATCCGGAAAGCTGCTGAGGCAGGCGCTCG
ACTGGCAGTCCTGCCCGAGTATTCTCTCACCTCGTGGGTCCCGGATGACC
CTGGATTTGCGGATGCCCATGTCGATAGAGAGTACCTTTCTAAGTTCTGC
GAGCTAGCGAAGGAATGCAATATCAATATTGTCCCGGGGACGTTCGTTGA
GAGACATGTTGACGATGGAAAGGATATGCTGTATAACGTTGCCCACTTCA
TTTCCAATGAGGGAAAGATATTGGGCTCGTATACAAAGAAGAATCTTTGG
TTTTTGGCTCTACTTTGTCCCAGTGGTTATGAGCTCGGCTAAGGTGTGGA
TAGGCATACTGAGAGGGCGCACTTAGAGGCCGCTGGAAACAACCCGCATA
CAGTTATGGACACTCCGCTGGGAAAAGTCGGTCTTTTGATATGCTGGGAC
TTGGCATTCCCAGAAGCGTTTCGGGCACTCATAATCCAGGGCGCAAAAAT
CATTA

NCBI BlastX