?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD45YK01FM1
Length(NT) : 304
Member of Contig: Contig1599


Sequence:

>SY0AAD45YK01FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGGCTCCATGACGATGACCC
CGTAGCCCTCTGCATCCTCTTGAAAGCTCTGCACAACCACCCATCCGTTC
CCCGTTCGCTGACCTTCAGGCAGCTGGTCAAGATGGCCGTCGTGGTGGAC
AAGTATGATTGCTCCCACGCCACCAGAATGTACGGCGATAAGTGGATGAA
GGGCTGGACCTCCAAGGCTGAGAAGGCGGGGTACGAGGAGTGGTTGTTCG
TGTCGTGGGTGTGGGGCGTGGAGAAGATTTTCGGAAAGCTTTTCGGGAAG
GTGG

NCBI BlastX