?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD44YP18FM1
Length(NT) : 615
Member of Contig: Contig3768


Sequence:

>SY0AAD44YP18FM1
TTGGGGCATCGCCGGCACCCCAGAAACGAAAGGAACGCCGGCCGGTCGAA
GATGGAGAATTAGTAAAGCGTCAGAAACAGAACAACTCTCGCGAGCCACC
CAAGGACATCTCCCTGCAGGACATTGGCGGCAGAGAAGAGGTTGTCGACG
ATCTTTTGAAGTTTATGACTATGCCTCTAACCCACCCAGAGGTTTACCTT
CATACTGGAGTGGACTTGCCTCACGGTGTACTTCTCCATGGACCACCTGG
CTGCGGAAAAACTATGCTAGCAAATGCTATTGCCAGAGAGGTTGGGCTAC
CATTTATTGCCTTTTCCGCACCCTCAATCGTATCAGGAATATCGGGAGAA
TCGGAAATGAAGCTAAGGAAACTTTTTGAGGAAGCACGGGAAATAGCCCC
TTGCTTAATGTTTATGGGTGAAATAGACGCTATAACACAGAAGAGGGACA
ACACCCAGCGGGATATGGAGAGAAGAATTGTTGCCCAGGTGTTGACCTGT
ATGGACGATCTCGCATTGGAGAAGACTGGTGGGAAACCTGTCATGATCAT
TGGAGCAACAAACCGACCCGACAGCCTAGATCCAGCATTGAGAAGAGCTG
GAAGATTTGATAAGG

NCBI BlastX