?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD42YC23FM1
Length(NT) : 553
Member of Contig: Contig1421


Sequence:

>SY0AAD42YC23FM1
TTGGGATGTTCGTTTCGGGCGAAACCGGCGAACCATCTGCAGAAACCACA
GGAATCATCGAAGAGATTGTGCGGGGCCAGGTTATCGAGATGTTGCAACA
ATGCACCAATCTTGCGTCACGTCGCGGGTCTCGCTCCATTTCGACCGATG
ACCTCATCTTCCTCATCCGTCATGACAAAGCGAAGGTTTCTCGCCTACGA
ACTTATTTATCCTGGAAAGATGTTAGGAAAACCGCCAAAGATAACGATCC
ATCTGGGGGAGCTGGTGCGCCCGATCCTGCCGACCTTCTCGACGACGCGG
CTGCAGGCATTGCGGGCGGGACTGGGCCGGTTCAGATGAGGCAGAAGAAG
GCAAAGATCGGACTCCCATGGGAGGTGGCTAGTTTTTTCTCGGAGCAAGT
CCCTGAACGCGAAGAAGATGAGGACGAAGACGAGGTAGAGGCCAACGCGG
CCACACTACAGCGCCTCAAGAATGCGGATGAACGTACGAGAGGTATGACT
AGGGACGAATACGTACATTGGTCGGAATGTCGCCAAGCTTCCTTCACATT
CCG

NCBI BlastX