?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD30YE12FM1
Length(NT) : 618
Member of Contig: Contig1040


Sequence:

>SY0AAD30YE12FM1
TTGGGGTGGCAGTCCGGCGGAGTCCTTAGGGATCAGGATCAATGCATTTG
CGGAAGCTTTGTATGTGGTTCCATGACCTCCAGCCTCGTCTGGCTCCGGA
TCCTGTACCTCATACCTAAGGGAGTGCTGTGTGAACAGTATTCCTTGGAC
ATGGTGCAAGGGTGATTTCGGAGTTCATACTTCCGCTTATTCCCATCCCC
GGCGATACCAACTATGATACACTGAATCCACATGCCCTCGGCATTTTTTT
GTTTCGGCAGACGGTATGCAACTTCAGAATCTTTCTGGAGGCCATTGTGT
GGGTCGGGTGCCGCGGACATGCTTCTGGCAACCTTTGTATTTCGACTGGA
TGGGCTATCGGCAGCACCAGCGTCGTCGATTTTGCGCTTACGCTTCTTCT
CGCCTGTGGATGGAGAGCAAATTGGTAAGCGTAACTCGAGAAGATACGAA
ACAACCAGTACGGGGAGGCTGAGGACCGGATTGGTACGGAAAACCAGGAA
AACGCCATGAGGGAAAGTATAATTAACAACACACAGCACGAGAGTGACGC
AAGCTAGTAATCACAAGAGCTACGAAAGGTGAACAGTAAGAAGGATCAAA
ATTTCTTACCTCCTCTAT

NCBI BlastX