?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD21YP16FM1
Length(NT) : 611
Member of Contig: Contig5573


Sequence:

>SY0AAD21YP16FM1
TTGGCTCCCCTACAGTTACGGCTAGGCAAATGTCGGTACTCAGGCCCGTT
GGTCGGTCGCTTCTGGGCCCCAGATCCTCTCGACACCTGTGCGCCCTACA
GTTCCAGCATTGCTACTAAATAATAGGTCACTTTTCACCCCCACTCCGGG
GCAGAAGCGATCCAGCTTCAAGTCATTTGTTGCGAGGTGGGCTGTGGCGG
GTGGTTTGATTTACGCGTATGCTACTTCTAATGTTTTTGCTGATGAGCCT
AAATTCCCCCAGGATGAGCTGAAGACTATACCCCCCGAAGACCAGGACCG
CCCAAAGTCATTGCTACCCGAGAAGGGAGGGAAGTTGGGAAGGCGGCAGA
GGTCGGACGCTGAGGATGATGGGCTCTTGACCGCGGATGAGGCCCGAGGA
GGACCGGAGGATTTGGAGGCTGAGGCGGGACAAGAGGGGGCCTTTGATCT
GGAGACTGGAGAGATTAATTGGGATTGCCCTTGTCTTGGTGGAATGGCTC
ATGGTCCTTGTGGGGAAGAGTTCAAAACTGCTTTTAGTTGCTTCGTTTTT
TCGAAGGAAGATCCTAAAGGCGTGGATTGTATTGAAAGGTTTAGGGATAT
GCAAACTTGCT

NCBI BlastX