?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD18YC05FM1
Length(NT) : 563
Member of Contig: Contig1368


Sequence:

>SY0AAD18YC05FM1
TTGGAAGCAATATACCAAATAAATCGAACGCCGTCCCGATTATCCCCACG
GAATCTGACAACGGTCACCCGTCCTTCCTCAATACTCCGCCACAAACCTC
TCCCAAATGTCATATCTCGAATCAACACCACTACCGCCACTACCACCCCA
CCAACCTCTCAAATCCCACCTGAAATTTATGAACCCCCAAAGTCGGGCCT
ACTCTCCCACTTCCCCCGGAAAACAATCCCTTATGCAGAGCTTATCCGCC
TCGACAAGCCAACAGGGACAATCTACCTCTTCCTCCCATGCCTCTGGTCA
ACACTCCTCGCTGGAACCCTCACGGATCCAGTAACTCCCCTTCCAACAGT
TCTCGGTACGACCTTCCTCTTCGCCACTGGCGCGCTGATCATGCGTGGAG
CCGGCTGCACAATTAACGACCTCTTGGACCGCAACATAGACCTGCACGTC
TCGAGGACCAAGTTCCGACCGATCGCCCGCGGCGCAATAACGCCGTTCAA
TGCTCTGGCATTCACATGCGTACAGCTACTCGCGGGATTGGCCGTGCTCG
TGCAGTTCCCGGC

NCBI BlastX