?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD17YO07FM1
Length(NT) : 110
Member of Contig: Contig181


Sequence:

>SY0AAD17YO07FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGCCGCACAACTTTGTACAA
GAAAGTTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTT

NCBI BlastX