?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD16YD22FM1
Length(NT) : 654
Member of Contig: Contig4328


Sequence:

>SY0AAD16YD22FM1
TTGGGACTACGACGACCGCAACGAGTAGCAATCATGTCTTTCGGAAGCTT
CCAGTCAATATGCGAGACGGCGAGTATACCACTCTGCTCGCTGGTGGGAC
CTTATGGCTCGTCGAGAGTGATGAGACCGGGCATCGAGGCGCTGTGCTAC
TCACGAAGCATAGAAACGGCAAACACAATCATTTTCCAGCTTGCTAACGA
CTTTGTTCATATTCTCGCGCTGATTATGTGTTCAATAATGGTACTTCACG
TACGGTCGAAATTCACCGCTGTTGGTCGGAAGGAGATCACCTCATTCTTT
TACCTGTTTATGCTCCTCACTGTCATTTCCCTCTGCCTTGATTCTGGCGT
CATCCCCATCGGGTCGGCTCCGTACGCATACTTTACCGCTGTCCAAGCCG
GCTTAACATCAGCCCTATGCACATGTCTTCTCATCAACGGGTTCATCGGG
TTTCAAGTTTACGAAGATGGCACCGCGCTATCAGTATGGCTCCTGCGACT
CTCGACGGTAGCAATGTTTATCGTGACCGGCGGCGTCGCAATTTGCACAT
TCCAAAGTTGGATCGGACTAAGCCCCACCAAGACTATGGCGCTCTTCGTC
GTCCTCTATGTTGTTAACGCTCTTTTCCTCTTTGTCTACGTCGCCTGCCA
GGTC

NCBI BlastX