?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAD10YE18FM1
Length(NT) : 563
Member of Contig: Contig5908


Sequence:

>SY0AAD10YE18FM1
TGGGCATTTGGCAATCAAGAACTGGCGAGGACTATTCTTCACCGCAAGGC
AGCGGCGGTTCTACTACCGGGGCCAATATCGATGTTAGAGGCGACAATAG
CGGCAACTCCGGCTCTCATAATAGGTTCTCCTCCCATAACATCACCACCA
TCTTCAATGTCTGGGGCACAAACTCCTCCCAGAAACATGACGAAATTTTA
CAATGCCTATACACATCCAGCTACCCGTCGCACCGAGCCCGGGTTCGTGA
GCCGACCGAGGGAACGTGCACTTGGGTTACGGAACATCCGAAGTACAAGG
ACTGGTCGGAGAAGAAGAAATCAGGTCTCCTCTGGCTATCGGCAGACCCA
GGTTGCGGGAAATCGGTCACCGCTTCCTTCCTCATCACACACCTAAAGAC
ACAGACGGATGCCATCGTTTGCTATTTCTTTTTCAAGGACGATAGTGATG
AACAAAGGAGCCCAACATTTGCTCTTTGCGCCCTGCTGCATCAACTATTT
TCAGAGAAATTCCCTCTCTAGACATGCCGAGCACGCCTTTAAGGAGAAAG
GAAAGAGGTTCAC

NCBI BlastX