?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC6YE12FM1
Length(NT) : 711
Member of Contig: Contig4011


Sequence:

>SY0AAC6YE12FM1
TTGGCTGGATTCCAGTTGTGGAGAAACCCCTACGCACCCCGAAACGAGTG
AGAATTATTACTGTAGGTGCTGGGCATTCCGGATTAATGCTTACGTACAA
GATTAGAAACCAGTTCAAGTACGGGGACTTTATGGACCACATTATCTATG
AGAAAAACCATGATATTGGCGGAACGTGGCTTGAGAACAGATACCCAGGG
GTTGCCTGTGATGTTCCTGCTCATATATACACCTTCTCATGGGAGCCAAA
TCCGGACTGGAGCGAGTTTTACGTTGGCGGAGAAGAAATTTTCCAATACA
TGAAGCGTACAACGGCGAAATACGACCTTGCAAGAGATGTTGTTTTCAAT
TCCAAGGTTGTGGAAGCCATCTGGGACCAGGGGCGAGGTAAATGGGAGCT
CAAGATTGAGCAAGAGGGACGATTTATCTGGGACGAATGCGATATCTTTA
TAAACGCCTCAGGGATCCTGAATAAATGGAAGTTACCATCCATTGAAGGA
ATAAACGCTTTCAAGGGACACTTGGTGCATAGTGCGAAATGGGAGGATAC
TTACGACTTTGCTGGAAAGAGAGTTGGAATTATTGGAAACGGATCTTCCG
CACTTCAGATCGTCCCCAAGCTACAGGAAGTCGCTGGACACCTAGTAAAC
TTCATGCGTACCCCAACCTGGATTAGTGCGACATACTCTTCTGAGCTTCT
TCCTGATGGAA

NCBI BlastX