?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC5YE17FM1
Length(NT) : 516
Member of Contig: Contig1304


Sequence:

>SY0AAC5YE17FM1
GGTCCACACCTCCCATGTTGGCAGCCTAGCTTCTTAACTCTCAGTTATCT
TGCGACCTATTTAGCATCCCCTTCCCTCTCGTCCCCCCCCCCTTCCCTCT
CCCCCTCTATCGCCCTAGTAAACGAACCCTCCTCCAGTCTCGAAAATACT
ATCCACACCCATGTCCGTCTTCCCGGTTCGCCCACGCCCTCCCGACTCGA
ACTCCTCATAAAAAAGATATCGTGTCCGAACAACAAACACACAATTAAAC
AGCGAAAGACTCATTCAGCTCACATGGCAGACACAGCTACCGCCATATTC
GATTTCTCCGCTGTCATAGCTCTCAATGATGCCCTGGCTACGAATCAAAA
CAGCAACCCTCTAGTCATCAATCCCGAAAAAATTAGCGGGACTACTCCTC
ACCGATCCCTTGGTGACTTTACCCCCCTCTGGGATTTTCTAGGGTCCTCG
CCTGTGCCATGCACTACCACTGACGAGGACGACCCATCACCCCCCACCCA
AATTCATCCATCGCCA

NCBI BlastX