?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC55YB22FM2
Length(NT) : 603
Member of Contig: Contig4028


Sequence:

>SY0AAC55YB22FM2
TTGGCGCACCCAAACTTTTCACCAACCTCACTCCGCGAGCCATTCGCCAA
TGGGAGGCAACTGAGGGAGCCGGGAATACTGCTGCATCCATCGGCCGTCC
AAATTCTGCTTGCTCCAACTATTCTTCATCTTCGGATTCATCGCTTGATA
GCTTGACTACCTTTACCACAGCGGGAGGAAGTTGCACTAGTCCTGAAACT
GAGGCTTCCTTCTTCGCCGATGAGCCGGAGGGAGAGACTACCCACCTTAA
GCCTACCGATGCCGTAAGATGGAGTAGCAAGATACAAGATGGAACCGGAG
AGAAGGACAGTGCAAACCAGATCCGTGTTCGGAAAACCAAATGGACCGAG
GAGATGGACAACCATTTGTGGAGGACATATATAATATACCAACAGGATCC
TAAGATAACGCCATTTTATGTCTTGCCGGGGCAAGTCCCACCTTTGGGAG
TATGTTGTAAAGTCGCCAGGGAGACAAAAAGGAGTTGGAAAGAGGCCAAG
ATGGGTGATGGATGGAAAGGTGTACCGAGCACCCCGAGGCCCAAGAGAAA
ATCAAGGGTTTCGGGTTATAAGACGGAGAGTAATGATACTGCGGCCGGGA
ATA

NCBI BlastX