?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC54YE12FM1
Length(NT) : 554
Member of Contig: Contig102


Sequence:

>SY0AAC54YE12FM1
TTGGCATTGATCTCGTTGATGCTTTCTAGTCAAACCAAGGATACAATCAA
CGCGGTTGCCATGAAAGGTCTCCGGGAGCAGCTTCCAGGGGGACTTTGCC
TAGAGAGTATTTTAGAAGTAGAGCCAAAGAGATTGGACGAGCTTATTAGG
ATTGTCGGCTTTCACAATCGAAAGACGGAATACATCAAGAAGGCGGCGGT
AATCATCCGGGATAAACATGGTGGTGATATTCCCGATACCTTTGAGGGTC
TGACGGCCTTGCCTGGCGTTGGTCCTAAAATGGCGCACTTGTGCTTATCT
GCGGCATGGGACCGAACCGAAGGGATTGGTGTCGACGTCCACGTCCATCG
GATTTGCAATCTTTGGGATTGGGTCAAAACCACTACTCCGGAAGGGACTC
GGGAAGCTCTGCAGGCTTGGCTTCCAAGGGACAAGTGGAGGGAGATAAAC
TTCCTCCTGGTTGGGTTTGGACAGACAATATGTCTCCCCAGGGGGAGGAA
ATGTGGAGAGTGCGCTCTATCGAGTGGGTTGTGCGGGGCAGCATACATGG
AACC

NCBI BlastX