?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC53YN14FM1
Length(NT) : 464
Member of Contig: Contig4082


Sequence:

>SY0AAC53YN14FM1
TTGGGATGCTTCCAAGTGCCATACTCACGCTGCTGGCAGTTTTTGCTGCC
GGGGTTGTGGGTTCCCCAACCGGAATTCCACAGGACGACGTAGACCGGGA
TCGTACTATTGAAGAACTCTTGGCCATGGACGCTGACCTCGTTGAGAATG
ATATCGAGACTTTTTCACCCAAGGCCAGTGCTCGTACTATCAGCGAGTCA
GAACTAGCCACAGTGTACTATTACGCTGAATTCGCAGCCGCAGCGTACTG
TGATCCTGACCATGTTCCCGGAACGGAAGCAAGCTGCAAGAACAACATCT
GCCCCCAGGTTACCGCGAATAGCGTTACCACCATCATTGAATTCGCAGAC
ACTACTTCCTCCGACACAACCGGCATAGTGGCCCGCGACGACACCAGACG
AACTATAACCGTTTCCTACCGCGGCACACAGTCCTTAGGGAACTGGTTCG
CGAACGTCCAGATC

NCBI BlastX