?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC52YE09FM1
Length(NT) : 608
Member of Contig: Contig1430


Sequence:

>SY0AAC52YE09FM1
TTGGACCACATGACGCGGACGCACTCATTCGGATTCTGAACTCCCGTGTA
TTCTCTGGAAACCTTACTGGTATGAACTATGACGATATGTATAATGATAT
TCCTACCTACGACAGTGATAAAGACGAGTCTATTTGGGAGGGTCAGAGCG
GCAATGCTTATGGTGAAGGGACGAGACGGGGCTCAATAGGGAATCGCAAC
TTGTCCAGGTCTTCTACTTGGAAGGACGATCGGGATAGTGGTTCTCCGCG
TGTGGTTTCTAGGGCGTCTACATGGCAGGACGATGTGTACGATCGGGATA
GAGATAGGGGCAGAGATGATCCTGCTGATTCCGCATGGAGAGCGTCGCAC
CGTCCGGACCCTGCTCAGACGTTCGACAAATATGAGAGTTCCAAGAGCAC
TCAATTCCAGAGGCAGCATTTCAACAGCACCTACTCTGATAAATCACCTT
CACCCAAGCGGCCCACAGGGCCCAAACCGGTCTTCAAACCGAAGCCACTG
TTCACCAATAAGGCCGAACTAAATGCCAACCAAGCTATTGCGCTATACAC
CTTTGAGGCGGATCAACCAGGCGATTTGGGTTTCAAAAAAGGTGATATCA
TCACCATC

NCBI BlastX