?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC51YI07FM1
Length(NT) : 232
Member of Contig: Contig372


Sequence:

>SY0AAC51YI07FM1
TTGGACCCACCACCCCGGACACGATTGTCCACCGCCATGGGCTCAACCAC
CATATTGAATCGCCCGCAGGCTGCTTCCGCATTGTCAGCTTCACCAAAAG
TTGTCAAAAACAACAAATCTCTCGCTAGCAGTTCGGCCGCTCCTTTAACC
TATGGTTGTAACCATATCGAAAAGCCTCTACAGGGCCCTACGGAGGGTAA
TAAGATGAGGGTCCTTTACGGTAGCGCCACTC

NCBI BlastX