?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC51YI02FM1
Length(NT) : 517
Member of Contig: Contig451


Sequence:

>SY0AAC51YI02FM1
TTGGCAATAGTCTAACGTACTGCAAGTACTACCAAACCACGAACAAAAAT
AAGGACACAAGACCGCCTCAATGTCCGCGGACAGAGAAGACCCAGTCCAA
GTGCTAATCCTCGGCGCTGGTTGGACCTCCACATTCCTGATCCCCCTCCT
CGAGGACAACAAAATCACGTACGCCGCCACGACCCGCAAAGGCGATGACA
ACTCCATACCCTTCGAATTCGACCCGCAGTCCGACGACCCGACGCCGTTC
CTGCCCCTGCCGTCGGCAAAGACCGTGCTGATAGCCTTCCCGATCAAGGG
CACCGGCGGGTCGAAGTTGCTCGTGACGCTCTACATGCGCACGCACCAGC
ACGTAAAGACGAACTTCATCCTATTAGGCACCACGGGGATCTGGCCGGAC
AAGGGCCTTCATGACCGCTTCACCATCCCGTTCCCCGACAATCCGAGGAA
GATTGCCGAGGACGAACTGCTCTCTCTCGGCGGGGCCGTGCTGAATCTCG
CCGGACTGTGGGGCGGC

NCBI BlastX