?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC48YE07FM1
Length(NT) : 603
Member of Contig: Contig1195


Sequence:

>SY0AAC48YE07FM1
TTGGCTCACCAACCACCAACCACCTCAACCTCATCCTCCGCGAAAAACAA
CCCCAATTCCTATCCGATAACAACAACAGCAACAATCTGCGAAAATGGTC
GAACTCCGTGAAGTAGAGGATGAGCACTTCGTCCACTCCCAACCTGCCCA
TTCCGACGACGAGGACTACACCGACACCGATAGCGAGATCTCAGAGGAGG
ACGAGGACGATGACGTCGACCTCGAGGAGTCCTTTTACGAACGGATCGCA
GCGCTCAAGGACATGATACCATTGAAGCAGAGGACCTACATTTCCAATGG
CTTCTCAAGGACTTACAACTTCTTCAGCAAGGGATTTGCGCTCGGTGGGA
AGACGCTCTGGATTCTTTCCACCAGTGCGCTGGTGCTTGGAGTGCCCTTT
TCTGTGGCGATTACGGATGAGCAACAGGTTGCCGAGATGGAGAAGGAGAT
GAAGATGACCCAGATAGCTACTGATGCACTCACCCCCGGCGCGGAATCGG
TACTCACCACCCCGCAAAAGTAATCTCAGAAACTCTCCTGTACAGAAAAC
ACTTGCAATGTATATTATTTTTGGGGGGGTTCTATTTTTTTCGTGTCTCT
CTT

NCBI BlastX