?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC46YC08FM1
Length(NT) : 457
Member of Contig: Contig4328


Sequence:

>SY0AAC46YC08FM1
TTGGGGAGAGGGAAAGGTATATTATAATATGAGTGTTGAATTCTGGTGCT
GACTCGGTTTTGGTGATATCACACCACTATGGTATTTGGGTAGTTAGGAC
AAGGGGGAAAGGGGAAGAGAAAGAAAGGTGCTGAGGGTAGGATACAATGG
GTACAGCAGGTATTGTGAACATGAGTAAGTGCGATAGGGTATATATATAA
AGACTCCCTTCCTCCTCGGGCATTGCCTACAATAAAGGAAGGGGGTGATA
AGAGAAAAAAGAAGCCGAAAAATCACCACCACCAAAAGAATAAAAAACAT
CCTACATCTAAAACCGCCAAGTGGTATATTATGTTTGCTCTTCCGTCTGC
CTTTCCCATCTTCGGTAAAATAAAAACAACCCCTCAAGATTGAAAGAGAA
GGGGAAAATAAATGGTTATGTAGAGCACGATAGCAGCCAAAGCCCCTACC
AAAGAGG

NCBI BlastX