?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC37YM19FM1
Length(NT) : 545
Member of Contig: Contig4041


Sequence:

>SY0AAC37YM19FM1
TTGGCGTGGTCTGATTTTTTCCCCTCCCTTACAACCCTACCAATATCCTT
ACCCCCTCTTTTTTTTTTTTTTCTTCTTCCTCACTCTCTCGCTCTTTGGT
TCCTTTACTCCTTTACTACCCTATTGAATCATAAGGTATCCTTTTCTGGA
CGGAGGGTTATTCACTCATTCCCCTCGTTCTCGTGCCCTTTCTTACCCCC
CCGCATATCACTACCTGCCTAAGGGGGGGGAAGATACTTGCCAAAAAAAA
AAAAAAAAAAAAGAATGCTTTGAATAGGCAGAGTACAACAAAAGGACCCC
CACCATACCCGATTCGGTATTGCACTCTACTATTGTACGGTACAGGTGCA
GTGCTCGGGTGTGTCCATAAAAATCGGAAAAGTATATCTCTTGTCTCTAT
AGAAATTTTATGGGATCAGGAGAAATAGTTTTCCAATTTTTACTGATGCA
CCCGAGCACAACTCCAATGGCACAAAAATGGAACCCACCCCCCTCACAGG
GTCCCTATCAACGAGCGCACAGGGTTTGTACAGTACCCGTACGGG

NCBI BlastX