?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC34YN15FM1
Length(NT) : 557
Member of Contig: Contig4531


Sequence:

>SY0AAC34YN15FM1
TTGGCAACAACAACCACAACCTACTCAACTGCCATCCACTTCCAACAGCA
ATAGCAATCTTTCCCAGCAACCTTCCTCCCAACCTTCTTCGGGCGCGTCT
TCGCAAAGAACATCGACCGTTTCTCCTAGCAACAAAGAGCAGCCTCATCC
ACCACCCTCTACATTAACTCCCCAGACGAAAAAGTCGACCCCGACCCCTA
CGAATATCAGCCCTCGGCATCCCCCGCCCCAGCCGTCATCGAGTCCAAAG
GGTGCGCATCAGTTGGGTCCACCGCCCACGCCATCTCAGAATCAAGCGAT
CGTGGAGGGAGGTACCAGCAGTAGTCCCGGGTCGTCCGGGCCTCCCAAGA
AAAGAGCTCGAAGAGATGAGGCTCCGATCTGGGCGAGAAAAGCTAGTCGG
AGTTCTAGTAGTAGCCCCGTATTGGCGAATAGGAGACAACCAAGCAGCGC
AAACCAGCACCAACCTCCTCTGCAACAGCAGCCGCCGCCGCTTCCGCCAC
CGCCTCCACAACAGCACCAGAAACCTCCTCCGGCAAGCGGATTTACCCCC
CGTTTTG

NCBI BlastX