?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC32YP17RM1
Length(NT) : 209
Member of Contig: Contig4447


Sequence:

>SY0AAC32YP17RM1
GGAGGGGTAAATAAAAACTTTAAAGATCCCACTTGACAGTTTATCGTTGG
AATTGTACTTCGCACAGCGAACAAGATCAATGGCTACGATATCCCGAGCG
GTATCTGGTGAAGAAACCAGGCAACTATCCGCAACACGTGGTAGCTTCCG
CCCTCAGTATATCACCCAATATCGGACTCCTGCTCCCACGTCACTCTAAT
CCATCTTCT

NCBI BlastX