?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC29YH03FM1
Length(NT) : 553
Member of Contig: Contig4284


Sequence:

>SY0AAC29YH03FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGAAGATTGCGGGGGTTTTT
GAGAAGTCGTTGTCGGAGGATCAGGTTAACCTACTGGGGGACTGGCTGTG
CGAGAGGCAGCTACCGAATGGAGGGCTTAATGGACGGCCGGAGAAACTGG
AGGATGTGTGTTATTCCTGGTGGGTGTTGAGCAGTATGGCTATGATTGGG
AAATTACAGTGGATTGATAGGGAGAAGCTAGTCGAGTTCATACTTTCTTG
TCAAGATGAGGAGAACGGGGGGATTGCCGACAGGAAGGGAGATGTAGCGG
ATGTTTTTCACACAGTCTTTGGGGTTGCTGGCTTGAGTTTGTTGGGCTAC
GAGGGACTCAAGGAGGTTGATCCTGTTTATTGTATGCCAAAGGATGTTAC
TGACAGGATTGTATGGAATCATCGAAAGATTCTTACAACTTAAAGCCCTC
AAAAATTACTTCATAAGCAATAATATCCACTCCTCGAGTAAGTCAGTCCA
AACATCACAATCCATCTCGCAACACCATTCAAAAAGCAATTGAAGCTGCT
ATC

NCBI BlastX