?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC28YO02FM1
Length(NT) : 613
Member of Contig: Contig3909


Sequence:

>SY0AAC28YO02FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAACTTCGTGAGCTATCGGT
CGTTATCTTCGGGGAGTCTCGCGCTACAGAATTGTAGCATCTCTATACCG
GTAGAATGCCGGAGAGGCACTTGCGTATTGCCCGCTTCGTGAGCTTAGCT
GCCTCGACATGTATTTCACTAGCCTGTGGGACAAATTATGTCTATTCGGC
CTATGCCCCCCAACTAGCCACTAGGCTCCACCTCACTGCGACGGAGAGTA
ATTTGATTGGAACATTTGGGAATTTAGGAATGTACCTTTCGGGGATACCA
AGTGGAATTCTAGTGGACTCTAAAGGGCCCCGGCTGCCTCTTCTCATAGG
TGCTGCGGCATTGCTGATTGGGTATTATCCAATGTATCTAGGTGAATGAC
CTAACCCTAATCCCTCCAGAGTGGCCAGGCATGATCTAATCCTTCCTAGC
CATGGAGGGTGGGAAGGGATCGACGAACGTCTTCGCGTTGTGCTTTTTCT
CCGCACTCACAGGTGTCGGGAGTTGTTGCGCCTTTGGTGGAGCCATGAAA
GCTGCTGCTCTCAATTTCCCACAGAATCGAGGGACAGCAACGGCTCTGCC
CTTGGCGGCTTTT

NCBI BlastX