?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC28YH15FM1
Length(NT) : 358
Member of Contig: Contig4011


Sequence:

>SY0AAC28YH15FM1
TTGGCAGTCTTCTTCATATCGAAGTCTTCATTTGCGAGCCTCACTATCTC
TCCATAATGGCCCCACCTCATGTCGATGATCAGTACTCTGCGGGCTCCAC
CTACCCACCAAACTGGATTCCAGTTGTGGAGAAACCCCTACGCACCCCGA
AACGAGTGAGAATTATTACTGTAGGTGCTGGGCATTCCGGATTAATGCTT
ACGTACAAGATTAGAAACCAGTTCAAGTACGGGGACTTTATGGACCACAT
TATCTATGAGAAAAACCATGATATTGGCGGAACGTGGCTTGAGAACAGAT
ACCCAGGGGTTGCCTGTGATGTTCCTGCTCATATATACACCTTCTCATGG
GAGCCAAA

NCBI BlastX