?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC28YA21FM1
Length(NT) : 655
Member of Contig: Contig4082


Sequence:

>SY0AAC28YA21FM1
TTGGAGACTACCATTGGTTTTTGTTTAGCTGGGGCGTCTCACACAATTTC
TACACATTCTCTTTCTCTCTTTCCTTTACGATGCTTCCAAGTGCCATACT
CACGCTGCTGGCAGTTTTTGCTGCCGGGGTTGTGGGTTCCCCAACCGGAA
TTCCACAGGACGACGTAGACCGGGATCGTACTATTGAAGAACTCTTGGCC
ATGGACGCTGACCTCGTTGAGAATGATATCGAGACTTTTTCACCCAAGGC
CAGTGCTCGTACTATCAGCGAGTCAGAACTAGCCACAGTGTACTATTACG
CTGAATTCGCAGCCGCAGCGTACTGTGATCCTGACCATGTTCCCGGAACG
GAAGCAAGCTGCAAGAACAACATCTGCCCCCAGGTTACCGCGAATAGCGT
TACCACCATCATTGAATTCGCAGACACTACTTCCTCCGACACAACCGGCA
TAGTGGCCCGCGACGACACCAGACGAACTATAACCGTTTCCTACCGCGGC
ACACAGTCCTTAGGGAACTGGTTCGCGAACGTCCAGATCCGCTGGAGTGA
TGCTTCGGTTTACTGCTCAAGCTGCAAGCTCCACACCGGTTTCTACAATG
CATTCAGAGACGCGTTCCCACCCATCCTCGCATCAATAAACTCGCTGCGC
GCCCA

NCBI BlastX