?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC27YH19RM1
Length(NT) : 395
Member of Contig: Contig4205


Sequence:

>SY0AAC27YH19RM1
CGATTAATCGTATTTTTATTTAGTCATCTACAATATAATCCCAACCAAAA
AGTCAAAAAAAGAATGAAATAAAATAAAATAAAAAACTACCGTTGATTGA
ACCATCTACTGATAACACCGCGACCCTTCTCTCCCTAGCTGCGTTTTTTG
ATTTGAATTCGAATTTGGTTTGGTTTAATATACACGCTTGAAAGGCGGGA
CCGCCGCACACTCCTTCTCATCTAGGGTATTTCCAACGACTGCACGGTAT
TTCAAGTCGACCTTACCGTGTTGCTCCTTCTGCCACGACAGTGTATGCTT
CATCCAGTTCTCATCGTCACGTTCAGGGTAATCTTCTCTTGCGTGCGCTC
CACGAGACTCCTTTCTGGCCGCGGCCGCGTGTGCGGTTTGAGTAG

NCBI BlastX