?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC26YD20FM1
Length(NT) : 652
Member of Contig: Contig4143


Sequence:

>SY0AAC26YD20FM1
TTGGGGAACTCTTCTGTTCCCCGTACAGAGGGCCAGGATGGCTATTCACA
CTTTACACGATGGAGTAACGCTCTTAAGGAGTAATAATGATACGCACATC
GGACTTCCGACAGATACGAGGAGGACCGATTTACCAACCCAGCTAGTTAT
CTCCACGACTCTTGGATTGGGTGCTTTCTTGACGTTTTGTTTCTTGAGGC
CAAGGTGGTCCTCGCTCTACGCGGCGCGGAAAAAGACACTTGATTCAGGT
GAGCTGAATGGGGATCTGAGGGCTGCGTCATTACCGAATTTACCAAAGAC
TTTCTTCGGCTGGATACCGGTGCTGTGGGAGATAACGGATGAGCAAGTAC
TGTCGTCTGCTGGTCTTGATGCCTATGTGTTTTTGTCATTTTTCAAGATG
TCTATTAGATTCCTATCGATTGCAGCTGTGCTAGCGTTGGGCTTGCTCAT
GCCTATACATCTGCACTTTGACCACTCGGTCTCGAAACCTCGGGTTTCGT
TTTCGGAATGGGCACTCAGACCTGCTGGTCGGGGGATGAATGTCCTTGGT
GGTAAAGATAAGGATGAAATCAAGCTTGATGGGCCATACCTTTGGGCTTA
CGTGGTGTTTGTGTACCTGTTCACTGCCTTAGCAGTCTATTTGCTTCTCG
AC

NCBI BlastX