?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC23YM20FM1
Length(NT) : 667
Member of Contig: Contig4396


Sequence:

>SY0AAC23YM20FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCCATCCCCCTCATCTCTTC
TTCCTCTTCCTCCTCCGCCTCCTCCCACCAATCAATGACATCAGTAAGAA
ACCAAAGGCGCACCAGTATCCCTATGATACATTACCTCCCACCTCACCCT
ACTATGATATTTCCGCCACTTCACTGCACCTCCCCCTCCAGGAGGAGGAG
GAAAGCTGATATCACCTACACATGCAACTTCGCCACGATGAAGATGCCCT
ATCATGCACCGCATTGATTATATTACTCTGCTCTTGTACGCTCCGGTTAG
ACTGCGGTACAATAATTTCTTATCCACCCAACCATCCGGGCCAATCGCTT
CTTTCCGAGGCCCACTCCACCGACATCATTGTCCGCCTTATTGTAAATCG
AAAGGAAACGGGTAAATCGCGCGTGGGAGGTGGTGCATAGCGGGGTGCGT
TTGGACTGGAACGGAATTCAATTGTCGCATCCTCCCCCCATTGTCCCCCA
CCCCTCGTGCTAATTATGCTATAAGGTGATTTTTCCTTCTTTCTGGGAAC
CCCTCACCACTCACGCAGGGCCTGTATTGGTTTCACCTTGATTTCCGCAT
GCAGTACTCGAGTACTGTACGAGTACTGTACGAGTACTGTGCTAATACAT
TATTACTTTTTGATTGT

NCBI BlastX