?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC22YD18RM1
Length(NT) : 214
Member of Contig: Contig1190


Sequence:

>SY0AAC22YD18RM1
GAGTAGACAACCATTTGTTTTACCAACACACGACTAATAAAGAAAAGAAG
AAAAGAATTACATGAAAGAAATAACCCGTAACAAATAAAATAACTAAAAC
GCAAAACAGGCAAAGAAGAAAAACCCCAGTGTCAAGGGGTTGAGAACACA
AGAGTAGAGAGAGCAAAGGGGGCAAGAAAATATTCCATTTTGTAATATAA
AGAGGAGGGGGGGG

NCBI BlastX