?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC20YF16FM1
Length(NT) : 656
Member of Contig: Contig3952


Sequence:

>SY0AAC20YF16FM1
TTGGATCCCGCCACCCCCACCACCAACTATTTGGTTCAACGATATTAATT
CCCTACAGCAACAGACTGTGTGAGAGAAAATAGTACTCAATGGACGAACC
AGAAGACGGTAACATTCGCAACGCTCAGAACAATATTCAAGATGCCGATC
TCTCGGATGAGACACAAGACTTTCGCTTCCTAAATCTCCTCAACAAGTAA
TCCCCTCTTCCCTCTCCTTTACCCTTTCCGATATTCACAACCCTCTAGAA
CAGGAACCACAGCTCTCCCCCGCCGCGGCGAGAAAGACTTTGAACCGGAC
GGCACCGACCTCCAAGACCGCGTCCTGAACGAGTCCCGGCAGGCGATGCA
CGAAGCACTCCTAGGGGAGCGTAAGCACTCCAGCAAACAGCACGTATCAG
CAACCTGGCGGCCATCACAGCGCATGGCAGAAGTTCACGTGGCTCGGGGG
CCGCACTTCAAGACGGTCGGGAAAGCCGACAGACGGGGGGTGTTGTGGTT
GCTGCCGGAGGAGACGATTTACCTGGTTGAAAGAGGGAACCTGGAATGTT
GGTGGGAGGAGGGCGTGCCGATGAGTTTGCAGGGGGTGTATGCTAGTGCG
CTTGATGGGTGTGGGGGGTTGGAGAGGTATCAAGTGTATACATATTTGAA
GAGGGC

NCBI BlastX