?> MycorWeb

Tuber melanosporum DB

You are here: Genome resources Tuber melanosporum DB EST & Gene Sequences View EST sequence

Tuber melanosporum EST database

Sequence Name: SY0AAC19YC09RM1
Length(NT) : 117
Member of Contig: Contig1543


Sequence:

>SY0AAC19YC09RM1
CATCTTCAACTCTTCTTCCCTTTATTCTTTCTTTCTTCCCCAACAAATTG
TTTTTTGAAACGGGTTGGCTATGTCACTCAAAGCCTTTCCTACCATTAAA
GCCATCAGGAGCTATGT

NCBI BlastX